Free My Coke Rewards Codes 25
April 6, 2010 in codes
Hello and Welcome! I’m ColaGal 
and I created this website to share My Coke Rewards codes with others- I do it for the pleasure of making someone’s day a little bit brighter. 
Several codes are posted throughout the day at random, and the taking is first come, first served!
If you are able to redeem a code from our site, please let us know by posting a comment that says “RBM” or Redeemed By Me. This way, other people don’t have to bother trying to redeem a used code.
Also, please don’t ask us to send codes to you individually. All the codes are posted at random- sometimes with a few minutes warning, sometimes not. Also, we do things like games and drawings once in awhile to mix it up and ensure that everyone has a chance at winning.
We are very happy to have you here, and wish you the best of luck snagging codes. All we ask is that everyone practice some common courtesy- if you’ve gotten several codes already one day, leave some for others the next. If we all share, there will be plenty of codes for everyone!
Please feel free to choose a name and join into the conversation. We appreciate any comments, questions, or (especially) codes that you would like to share! Thanks for visiting our site, and remember to check back soon for the latest codes and information. Also, don’t forget to check out our F.A.Q. and other pages (links are at the top). Here is our customary TEN POINTER for the new page! Enjoy, and please let us know if you get it. /*/F/*/4/*/4/*/V/*/7/*/A/*/B/*/A/*/M/*/X/*/V/*/H/*/ Thanks, and have a great day!!!
~ColaGal
P.S. Thank you to everyone who has been contributing to the site- we appreciate each and every one of you and can’t thank you enough for your generosity!
Coke-addict said on April 6, 2010
I am the luckiest person today to snag 10points in this new page, weeee!
F44V7ABAMXVH RBM
Thanks ColaGal!
BetaID said on April 6, 2010
Congrats on the new site ColaGal
ColaGal said on April 6, 2010
T,F,5,W,K,7,?,?,A,X,P,F (these two letters are not the varsity squad)
Good luck!
CodeCola said on April 6, 2010
TF5WK7jvAXPF RBM. Thanks for posting CG. Had me scratching my head for a while.
acein said on April 6, 2010
Didn’t get it!
Cyn said on April 6, 2010
TF5WK7jvAXPF RNBM. Thanks anyway.
Cyn said on April 6, 2010
Acein, JV for junior varsity. Sad part is that it sat so long, and was already used. I thought nobody got it, so I kept trying what I thought would work like jr for junior… I got locked out on one account.
Cyn said on April 6, 2010
Scratch that, I thought you mean you didn’t understand.
Bellyhop94 said on April 6, 2010
Heres a 20 Pointer to start off the new page
+A+7+B+J+7+V+H+T+5+T+F+A+
Cyn said on April 6, 2010
a7bj7vht5tfa RNBM thanks anyway.
acein said on April 6, 2010
A7BJ7VHT5TFA… RNBM!
ColaGal said on April 6, 2010
4,9,H,5,P,5,H,M,L,5,X,N
Thanks, Cokaholic!
Best of luck, everyone! Please let us know if you get it.
Cyn said on April 6, 2010
Thanks so much, both of you. I know Bryan Adams and his song. This threw me for a loop. Thanks again.
rock said on April 6, 2010
49H5P5HML5XN RNBM
But thanks for the cool site.
stephanie said on April 6, 2010
49h5p5hml5xn RNBM Thanks colagal ..gbu
ColaGal said on April 7, 2010
Hi CokeGirl- thank you, but I can’t figure out how to use it! I went to the website and it wants a promotional code, not a pin or a serial number. I tried both anyway, but it said invalid. Do you have any more info you could sent me or a link? (colagal@freecokecodes.com) Anyway, I really appreciate the thought!
Have a great day!
4,9,T,%,%,N,J,J,P,V,4,M – (these two numbers are what Sammy
Hagar can’t drive) Thanks, Cokaholic!
LSUFan said on April 7, 2010
49t55njjpvvm comes up as invalid for me. Thanks anyways
LSUFan said on April 7, 2010
49T55NJJPV4M was RBM. Did you correct that or did I copy it wrong the first time? Either way, thanks CG.
acein said on April 7, 2010
49t55njjpv4m… RNBM!
Cat said on April 7, 2010
April is my favorite month…How about some April Trivia.
April is my favorite month because my DO__ is in April.
On April 1st tradition is to play an April ________’s joke. (1st letter)
April has two Zodiac signs, Taurus and ______. (1st letter)
April’s ____________ is the diamond. (1st letter)
April __ifteenth is known as Tax Day.
April showers _ring M_y flowers, but what do M_y flowers _ring?
What number does this Roman Numeral stand for? IX
Ar_or day for most states is the last Friday in April.
Daisy and Sweet Pea are the two _________ for the month of April. (1st letter)
Happy Hunting
Cat said on April 7, 2010
49t55njjpv4m RNBM
Thanks ColaGal and Cokaholic
Cyn said on April 7, 2010
Is anyone else having a hard time getting the full page to load? It keeps getting hung up on the paypal, so I can’t tell if the other info has been updated or not. Maybe CG is trying to tell me something? Huh, huh?
. Way to go LSU. I’m glad you got the updated code, because you were first to alert CG on the problem.
naybutterfly1 said on April 7, 2010
0hrjlwp4wwm5
acein said on April 7, 2010
Cyn… yeah I am having a similar problem as well… seems like things aren’t loading, but it is my early day to leave work today so I am just about out of here!
acein said on April 7, 2010
0hrjlwp4wwm5… RNBM! Thanks naybutterfly1
CokeGirl said on April 7, 2010
Cat your code came up invalid!
BFGSFBAMB9BF
CokeGirl said on April 7, 2010
0hrjlwp4wwm5 RNBM. Thanks naybutterfly1
ColaGal said on April 7, 2010
Hmm… not too sure what is going on with the page not loading correctly. I haven’t done anything except publish a new post, so please let me know if it continues to give you problems and I will look into it.
LSU- WTG on the code, thanks for alerting me and sorry for being a little sneaky!
Cat- Thanks so much for donating, I hope someone claims it!
CokeGirl- I’ll go check my mail right now. Thanks so much!!
LSU Fan said on April 7, 2010
WooHoo! I got Cat’s Riddle.
It was BFABFBAAB9BF. RBM.
OK – I am done for the day. Thanks Cat, that was a good one.
Shaval123 said on April 7, 2010
Am I doing something wrong? All of the codes posted here are invalid and the site says that they have already been used.
Thanks
ColaGal said on April 7, 2010
Hi Shaval123 and welcome to the site! All the codes are first come, first served and can only be used once. We post them and whoever sees it first gets it. That’s why we ask that everyone post a comment saying Redeemed By Me or RBM if they were the one to get it. Please keep checking back for your chance, and best of luck!
F,K,V,L,L,V,N,R,F,&,&,K-(these two letters are not off) Thank you Cokaholic for the codes & puzzles!
acein said on April 7, 2010
Got it! fkvllvnrfonk… RBM.. Thanks ColaGal & Cokaholic.. and right before I was about to walk out the door.
Cyn said on April 7, 2010
CG, the page has been loading for over 30 minutes and it’s still “waiting for paypal.com”.
Coke Cap Collector said on April 7, 2010
My Birthday’s on Friday.
Bellyhop94 said on April 7, 2010
@ Shaval123
They say that because someone used the codes already.
They can only be used once to prevent Cheating.
lulou said on April 7, 2010
just found this site ~ waiting my turn to snag a code
ColaGal said on April 7, 2010
A,W,7,N,N,N,T,T,P,F,*,* (these two letters are not sm, med or lg)
lulou said on April 7, 2010
AW7NNNTTPFXL ~ didn’t work it was redeemed by someone LOL
ColaGal said on April 7, 2010
a.n.p.5.5.a.9.a.l.a.7.b.
Please let us know if you get it this time, thanks.
CokeGirl said on April 7, 2010
a.n.p.5.5.a.9.a.l.a.7.b. RNBM. Thanks ColaGal
cokelover23 said on April 7, 2010
need a code asap
CokeGirl said on April 7, 2010
Hey Cokaholic, do you know the brand of your headphones? or the model number? How are you feeling?
Bellyhop94 said on April 7, 2010
Here yall go
3 3Pts
ATLBV7AF6R5A
69VR??B56B7J (What number comes after 46?)
NRHWP9MPM5T? (What is the 6 letter in the alphabet)
eileen said on April 8, 2010
need codes plesase
stonermac said on April 8, 2010
ATLBV7AF6R5A
69VR??B56B7J (What number comes after 46?)
NRHWP9MPM5T? (What is the 6 letter in the alphabet) ALL RNBM
ColaGal said on April 8, 2010
0,4,4,K,X,B,~,~,R,K,K,A (these two letters are what Santa says backwards)
We’ve had some lurking lately, so please let us know if you take this code. We don’t want our very generous contributors to stop donating their codes! A little bit of common courtesy goes a long way!
LSU Fan said on April 8, 2010
044KXBOHRKKA was RBM! Thanks CG. That’ll be my only one for today.
acein said on April 8, 2010
044kxb0hrkka… RNBM! Thanks for the chance.
stonermac said on April 8, 2010
RNBM
0,4,4,K,X,B,~,~,R,K,K,A (these two letters are what Santa says backwards)
CokeGirl said on April 8, 2010
Only 44 points away to redeem the cordless headphones!!
ColaGal said on April 8, 2010
Thank you all for posting back!
The next code will be a big one.
ColaGal said on April 8, 2010
HERE IT IS!! R,W,L,+,+,V,T,7,T,J,F,7 (these two letters were always
in vinyl until they became obsolete)
(And just for the record, I still collect and love ‘em! No pun intended.)
acein said on April 8, 2010
RWLLPVT7TJF7… RBM! Thanks so much ColaGal!!!!
CodeCola said on April 8, 2010
RWLlpVT7TJF7 RNBM. That was tough. Took me forever to figure it out. I was way too slow. Thanks for that head scratcher, CG
Filia said on April 8, 2010
Happy almost Friday! RWLLPVT7TJF7 RNBM. Thanks anyway ColaGal (and Cokaholic?)
iheartcoke said on April 8, 2010
rwlp0vt7tjf7 rnbm
Coke Fan said on April 8, 2010
rnbm…Thanks anyway ColaGal
LoCoCa said on April 8, 2010
rwllpvt7tjf7 rnbm
CokeGirl said on April 8, 2010
rwllpvt7tjf7 RNBM. Thanks!!
ColaGal you made me laugh with your comment. I don’t remember the last time I played a LP.
Cat said on April 8, 2010
Happy Thursday! As most of you who frequent This sight are Aware, I post codes in Varying ways. I’ve got 7-9 codes Already I’Ve been holding onto and would Like to post as teasers instead of simply listing the codes, but need some suggestions on a different way to post them. 7 of the codes are fairly simple to come up with something, but the others have such a combination of numbers and letters that Right now I’m not able to figure out How I should post them to be different than other posts…if I could Just get a couple of suggestions I’ll post them to redeem soon.
Thanks guys,
Happy Hunting
LoCoCa said on April 8, 2010
nice one, cat! but tav79avl7rhj was rnbm
ColaGal said on April 8, 2010
Thanks so much for your code donation, Cat!
Unfortunately, it looks like the lurkers have struck again…
Hope you all have a great night! Another code is coming up in just a bit. Stay tuned and good luck!
ColaGal said on April 8, 2010
<,<,<,B,6,X,N,T,9,M,B,A (these three letters are a popular style of music)
stonermac said on April 8, 2010
RNBM
rapb6xnt9mba
ColaGal said on April 8, 2010
9,V,9,7,M,>,>,>,7,5,H,X (these three letters are what you get from being in the sun)
Thanks, Cokaholic!
Cat said on April 8, 2010
9v97mtan75hx has already been used. RNBM Hmmm…lurkers?
stonermac said on April 8, 2010
cool….I got one! lol Thank you so much!
9v97mtan75hx RBM
rock said on April 8, 2010
9v97mtan75hx
RNBM too late!
ColaGal said on April 9, 2010
Good morning, everyone!
{,{,6,0,J,9,V,F,5,L,P,X (these two letters are what this symbol means: @ )
Please post if you get it. Also, don’t forget that there are currently 3 instant win games on MyCokeRewards.com that you can play with free entries 2x per day! Check out our F.A.Q. page for more info.
Cyn said on April 9, 2010
AT60J9VF5LPX RBM, CG. Thanks so much for the 3 points.
I thought that the IWG were a total of 5 entries combined, your choice? I’m sure that’s what I’ve been getting.
acein said on April 9, 2010
AT60J9VF5LPX… RNBM! Thanks for the chance!!
Cat said on April 9, 2010
at60j9vf5lpx RNBM Thanks ColaGal
cokaholic said on April 9, 2010
Hey there ColaGal – I just emailed you a bunch more code puzzles – I have been watching and people are getting the puzzles – it is neat to watch. CokeGirl – those headphones do not have a brand name on them, but they have the same set on the Dell website so you can go on there and read all about them – they work great. I am loving everything I have got from Coke Rewards so far. I am feeling really good right now and I even worked some outside to get ready for tours mulching and stuff – I am not overdoing – I have a check up appointment today at 4:00 so I am off to the doctor. Have fun with the codes!!!!
Cyn said on April 9, 2010
Good luck at the Doc, Cokaholic. Glad to hear you are feeling so much better.
ColaGal said on April 9, 2010
Just got your message, Cokaholic. Thanks so much!!!
Here’s a code for someone. Please let us know when it’s redeemed, thanks. F-P-K-7-$-H-W-K-$-K-6-7 (these two letters mean kisses but not hugs at the end of a letter) Good luck!
LSU Fan said on April 9, 2010
FPK7XHWKXK67 was RBM! Thanks CG. TGIF to all.
ColaGal said on April 9, 2010
B,T,N,W,4,J,4,R,O,-,-,- (these three letters are a type of vehicle)
Good luck and please let us know if you get it.
Thanks again, Cokaholic!
CodeCola said on April 9, 2010
BTNW4J4ROvan RBM. Thanks for the code CG & Cokaholic.
ColaGal said on April 10, 2010
6,P,],],B,N,T,7,P,T,M,0 – (these two numbers finish this
sentence “Lordy, Lordy, look who’s ?)
LOL, thanks Cokaholic!
Hope everyone is having a nice Saturday! Please post if you snag it.
becky said on April 10, 2010
thanks colagal!
becky said on April 10, 2010
RBM 6P40BNT7PTM0
thanks!
ColaGal said on April 10, 2010
B,P,[,[,4,J,L,F,K,L,9,6 (these two letters are who
is married to the Mrs.)
Valdorian said on April 10, 2010
RBM BPMR4JLFKL96
Thanks alot!
Cokegirl said on April 10, 2010
Bpmr4jlfKl96 RNBM thanks ColaGal And Cokaholic
have a nice weekend everyone!
ColaGal said on April 10, 2010
6,B,K,=,=,=,M,A,O,R,F,J (these three letters are who
you call if your car breaks down on the road)
Cyn said on April 10, 2010
RNBM. Thanks anyway.
ColaGal said on April 11, 2010
T,T,J,+,+,4,4,B,4,B,+,6 (these three letters are what you wear on your head)
CodeCola said on April 11, 2010
TTJha44B4Bt6 RBM. Thanks for the code, CG.
Crandall said on April 11, 2010
Could someone email some codes to me please? caseygirl11@gmail.com
Crystal said on April 11, 2010
6bkaaamaorfj RNBM
Lisa said on April 11, 2010
Hey everyone its been awhile hmm I feel like being nice today by the way Colagal I love the new way your posting codes
mary4hadKaKlittleLlambVlittleVlambJlittleAlamb9maryWhadAa5
Let me know when its redeemed I may post another
Cyn said on April 11, 2010
4kklvvja9wa5 RBM. Thanks, Lisa.
NP said on April 11, 2010
4kklvvja9wa5 rnbm
stonermac said on April 11, 2010
4kklvvja9wa5 RNBM Thanks for the chance
Crandall said on April 11, 2010
well I tried both of these codes but they had already been redeemed
stephanie said on April 11, 2010
4kklvvja9wa5 RNBM ty anyways lisa and gbu
stephanie said on April 11, 2010
cyn that other site I’ve seen you on that give out alot of codes …I’ve seen u there alot … how do u manage to get so many …I always seem to miss them ..this site colagal set up I really like and in the couple of months ..I’ve only managed to get one got any tips ? to better my chances of grabbing a good one ty and gbu
BetaID said on April 12, 2010
Happy Monday everybody!!! Heres a little something to get rid of those Monday blues.
_^_^_^R^V^X^6^5^N^5^B^5
The first three letters is the Spanish word for bread. Yummm
Cyn said on April 12, 2010
Stephanie, it’s more dumb luck than anything else, combined with a passion — trying to get codes for our Special Ed Preschool because of all the budget cuts. When I get enough for those accounts, I add some points to three other elementary schools that have Special Ed programs in our area. Add in the fact that I’ve got a ruptured Achilles tendon, so I’m icing my heel a lot and have nothing else to do at that time.
I just keep refreshing the pages. It may seem like I get “many” but in reality, I don’t get that much, not if you consider how many sites I “babysit”. Good luck.
CokeGirl said on April 12, 2010
hello everyone. Happy Monday!
Cyn said on April 12, 2010
PANRVX65N5B5 was RBM. Thanks so much BetaID.
ColaGal said on April 12, 2010
N,F,R,?,K,X,T,?,4,W,?,N (these three numbers are just short of a grand)
Thanks to Cokaholic! Hope you’re all having an okay Monday.
Cyn said on April 12, 2010
NFR9KXT94W9N RBM. Thanks so much for the 3 points, CG and Cokaholic.
Mini! said on April 12, 2010
Hey ColaGal,
NFR9KXT94W9N comes up as already used. Help?
acein said on April 12, 2010
hmmm…. not sure! But thanks for the chance
acein said on April 12, 2010
Nevermind… I thought I was looking for an abbreviation with letters. Once I posted I saw it was numbers just short of so nfr9kxt94w9n was RNBM
Coke Fan said on April 12, 2010
Colagal’s code RNBM
ColaGal said on April 12, 2010
WTG, Cyn! 3 in a row!!
What a lucky duck you are!
Cyn said on April 12, 2010
ColaGal said on April 12, 2010
LOL
Another code in 30 minutes. Best of luck to everyone!!
ColaGal said on April 12, 2010
4//M//7//T//V//H//F//T//A//5//6//R//
acein said on April 12, 2010
4m7tvhfta56r… RBM. Thanks for the code ColaGal!!
Coke-addict said on April 12, 2010
4M7TVHFTA56R RNBM Thanks anyway
chikkimok said on April 12, 2010
4m7tvhfta56r rnbm i was just a few seconds late. ugh. lol. been waiting for it.
JustinM said on April 12, 2010
4M7TVHFTA56R RNBM
ColaGal said on April 12, 2010
T,@,K,V,K,@,B,5,@,X,H,J (these three letters are what you did if you didn’t lose the game)
Good luck, and please let us know if you get it!
acein said on April 12, 2010
twkvkob5nxhj… RNBM.
LoCoCa said on April 12, 2010
twkvkib5nxhj doesn’t seem to be working. maybe i’m typing it incorrectly though @_@
CokeGirl said on April 12, 2010
twkvk0b5nxhj RNBM. Thanks ColaGal and Cokaholic.
JustinM said on April 12, 2010
man someone still hasn’t said that they redeemed it
stonermac said on April 13, 2010
Has someone messed things up for everyone else?
acein said on April 13, 2010
Yeah… it looks like it was taken by a lurker.. I had used the word WIN instead of WON at first, went back and double checked all the letters I had typed and reread the post and figured it out a little too late… that costly error probably allowed the lurker just enough time snag it.
ColaGal said on April 13, 2010
6,R,#,V,H,5,A,6,A,#,V,# (these three letters are a brand of
what you spray on yourself to keep mosquitoes away)
Good luck, and PLEASE say if you get it. Thanks everyone! Hope the lurkers are gone…
Cyn said on April 13, 2010
6rovh5a6afvf RNBM, but thanks as always.
LSU Fan said on April 13, 2010
6ROVH5A6AFVF WAS RBM! Take that lurkers! Thanks CG.
acein said on April 13, 2010
6r0vh5a6afvf… RNBM… Thanks for the chance!
CodeCola said on April 13, 2010
6R0VH5A6AfVf RNBM. Thanks for posting, CG.
BigBopper said on April 13, 2010
6RoVH5A6AfVf RNBM
ColaGal said on April 13, 2010
5,%,B,5,K,J,9,%,B,J,%,6 (these three letters are the next size up from extra large)
Hope you’re all having a nice day.
stonermac said on April 13, 2010
RNBM
5xb5kj9xbjl6
LSU Fan said on April 13, 2010
5XB5KJ9XBJL6 was RNBM. Sorry. Thanks anyways.
cocacolagal1212 said on April 14, 2010
WOW WOW I WENT TOO MY LOCAL FLEA MARKET AT THE SNACK BAR I FOUND IN THE TRASH 7 20 POINTERS WOW NOW I GOT OVER 400 POINTS TOO ENTER WOW WOW I AM GLAD
ColaGal said on April 14, 2010
Wow! WTG cokacacolagal1212!
T,&,J,5,7,P,P,&,&,J,6,V (these three letters are a popular sandwich)
Please let us know if you take it, thanks!
CodeCola said on April 14, 2010
TbJ57PPltJ6V RBM. LOL I was trying sub, ham, egg. Finally got BLT
. Thanks for the puzzle CG.
ColaGal said on April 14, 2010
Thanks for posting back, CodeCola! All of these puzzles I’ve been posting lately were created and donated by Cokaholic. Thanks so much, Cokaholic!
ColaGal said on April 14, 2010
9,K,X,6,P,V,$,$,F,0,0,V (these two letters are the opposite of AM radio)
Cyn said on April 14, 2010
9KX6PVFMF00V RBM. Thanks, Cokaholic and CG.
boredsilly said on April 14, 2010
rnbm 9kx6pvfmf00v
Anyway thanks for putting it out here!
JustinM said on April 14, 2010
9KX6PVFMF00V RNBM
LoCoCa said on April 14, 2010
9kx6pvfmf00v was rnbm. just thought you’d like to know
CodeCola said on April 14, 2010
Thanks for donating the codes, Cokaholic!
Giri said on April 14, 2010
9KX6PVFMF00V RNBM
cokaholic said on April 15, 2010
Howdy ColaGal !!! I just emailed you a bunch of large pointers so check your email – I will send more as I get them done. It is very cool to see everyone solving these puzzles for the codes!!!!! I have three house tours done for this month and six more to go – I have even taken a couple of afternoon naps – not as much energy as I usually have – I guess I am still recovering. Everybody have fun with the codes and I will look now and then to see who gets them – DOWN WITH THE LURKERS!!!!!
ColaGal said on April 15, 2010
Thanks so much, Cokaholic!
R,O,R,5,M,&,J,&,N,K,T,7 (this is a popular group at county fairs)
Here’s a big one for everyone, please post if you take it!
acein said on April 15, 2010
r0r5m4jhnkt7… RBM! Thanks so much!!!
CokeGirl said on April 15, 2010
r0r5m4JHNKT7 rnbm. Thanks Colagal and Cokaholic.
I was really surprised I found the answer really quickly in Google
Cyn said on April 15, 2010
CG, again today, I can’t get this page to load. It keeps freezing up with paypal.
ColaGal said on April 15, 2010
Hmm…thanks Cyn. Is anyone else having this issue with the page not loading?
T,#,#,4,N,P,H,4,9,#,W,9 (these three letters are a sly animal)
CodeCola said on April 15, 2010
Tfo4NPH49xW9 RBM. Thanks CG & Cokaholic.
No problems on page loading or freezing.
Cyn: Have you tried a different browser?
Cyn said on April 15, 2010
Yes, I’ve tried IE and FF Chrome.
ColaGal said on April 15, 2010
Hope you’re all having a good night!
N,N,(,(,(,B,R,9,X,9,T,W (these three letters are the first name of the actor who played Opie) Thanks, Cokaholic!
boredsilly said on April 15, 2010
Cool! rbm nnRONbr9x9tw
Thanks!
CokeGirl said on April 15, 2010
NNRONBR9X9TW RNBM. Thanks again!!
jrmxCoke said on April 15, 2010
Had no trouble with the page loading. If I wasn’t full for the week, I’d try the clue with Mr. Howard. Good luck to all, except those darn lurkers- you need to go away… far away.
cocacolagal1212 said on April 15, 2010
since i got me soo many coke codes this 3 pointer i am giving away here is the code with 3 letters missing and i will give a clue T/?/9/0/6/?/5/?/5/W/F/W this is what a woman wears under her shirt that is a piece of lingerie
CokeGirl said on April 15, 2010
tB906R5Awfw RBM. Thanks cocacolagal1212!!
have a good night everyone!
CokeGirl said on April 15, 2010
tB906R5A5wfw RBM. I typed it incorrectly. Thanks again cocacolagal1212!
cocacolagal1212 said on April 15, 2010
and the rests i got i am saving them for me another year of the club pogo paid for since i got enough for another year too enter
ColaGal said on April 16, 2010
Good morning!
?,K,L,L,K,B,V,9,6,?,5,5 (these two letters are where you go to mail a letter)
Filia said on April 16, 2010
PKLLKBV96055 RBM
Thank you very much ColaGal and Cokaholic!
acein said on April 16, 2010
Pkllkbv96055… RNBM… thanks for the chance!
Giri said on April 16, 2010
RNBM
BetaID said on April 16, 2010
F X 6 0 4 K X 9 T 9 X 5
~~~
3 Pointer From a Fanta. Good Luck
Cyn said on April 16, 2010
FX604KX9T9X5 Thanks, BetaID. RBM.
ColaGal said on April 16, 2010
O,T,W,9,F,4,6,#6,B,#,P (these two letters are the abbreviation for pound)
Thanks, Cokaholic!
Cyn said on April 16, 2010
otw9f46l6bbp RNBM, but thanks as always to both of you.
BetaID said on April 16, 2010
Ten Point Code Coming Up @ 9PM EDT ~ 8PM CDT ~ 7 PM MDT ~ 6PM PDT
BetaID said on April 16, 2010
T N J R P R 7 J 9 4 V A
~~~
Ten Point Code From A 12 Pack Sprite. Good Luck
boredsilly said on April 16, 2010
rbm TNJRPR7J94VA
Thank you!
CokeGirl said on April 17, 2010
too late
BetaID said on April 17, 2010
No Problem
nik said on April 17, 2010
damn theres no codes tht havnt been used yet, can anyone help me out an send me a few codes plzzz i’d realllyy appreciate it c:
my email is xxnikksays@aol.com
ColaGal said on April 17, 2010
B,R,K,F,R,4,&,&,H,A,6,X (these two letters are Spiderman’s girlfriend’s name)
Cyn said on April 17, 2010
BRKFR4mjHA6X mj for Mary Jane. Thanks to both of you. RBM.
CokeGirl said on April 17, 2010
brkfr4mjha6x. RNBM. Thanks anyway!
CokeGirl said on April 17, 2010
Double points in April 22nd when you enter codes from Dasany 20oz flavored water.
Bellyhop94 said on April 17, 2010
RNBM.
Thanks! ColaGal
ColaGal said on April 17, 2010
0-R-?-H-J-6-N-6-5-B-?-? (these three letters are 2000 pounds)
Thanks again for these puzzles, Cokaholic!
And as always, please post a comment if you get it.
Cyn said on April 17, 2010
ORtHJ6N65Bon RBM. Thanks to both of you.
cocacolagal1212 said on April 17, 2010
wowwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww i got a lott lott of coke codes too enter right now i got a total of 534 points too enter in wowwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww
BetaID said on April 17, 2010
CocacolaGal1212 are those codes for us here? LOL JK
In a few minutes I will post a code!
cocacolagal1212 said on April 17, 2010
well i got enough for me too have another year of the club pogo paid for even though i got 3 then i will have another year makes 4 years my sister got 2 years my brother in law he got 2 years between us 8 years worth of the club pogo paid for yeahhhh
CokeGirl said on April 17, 2010
Hey BetaID hurry up with the code!! I want to sleep! LOL JK
BetaID said on April 17, 2010
7 W 0 A P M 0 5 F A V P
~~~
10 Point Code From a 12 Pack Coca Cola. Good Luck!
~~
If you didn’t get this one there will be another one later
jojo said on April 17, 2010
RBM… THANKS!
Cokegirl said on April 17, 2010
7 W 0 A P M 0 5 F A V P RNBM. Thanks BetaID … It’ kind of dificult to memorize the 12digits, change to other webpage using My cell phone
Cokegirl said on April 17, 2010
Ahhh And feeding my son… Well nezt time!
Have a great night everyone!
ColaGal said on April 17, 2010
You too!
And thanks to BetaID for the code donation!!!
BetaID said on April 17, 2010
No Problem ColaGal
~~~
N J T A F 6 J B T 7 F T
~~
3 Point Code From a 2 Liter Coke. Good Luck!
jojo said on April 18, 2010
RNBM, But thanks
cola monster said on April 18, 2010
hi im a new visitor, needed free coke reward points
ColaGal said on April 18, 2010
Hi cola monster!
*waves* Welcome to the site!
&-M-&-7-5-L-P-J-J-X-B-F (when you take a vacation or a few days off you are taking a little…)
Thanks Cokaholic!
(And p.s.- it’s a big one!)
boredsilly said on April 18, 2010
rbm RMR75LPJJXBF
Thank you ColaGal!
CokeGirl said on April 18, 2010
I gave up. I tried so many combination. I don’t want to be locked out from the site.
Hope somebody can figure it out!
cola monster said on April 18, 2010
uhh is the part in parenthesis a clue of what the two-letter word is?
Cyn said on April 18, 2010
When I tried R R it said “invalid”. Go figure.
Endymion said on April 18, 2010
RNBM – RMR75LPJJXBF
Cheers.
Endymion said on April 18, 2010
How many points was that one worth, by the way?
CokeGirl said on April 18, 2010
Can you let me know what RR mean?
cola monster said on April 18, 2010
nice boredsilly, did you guess and check?
Cyn said on April 18, 2010
Usually we asy “R and R” for “rest and relaxation”.
Cyn said on April 18, 2010
Sorry, typing in the dark, that should have been “say” not “asy”.
boredsilly said on April 18, 2010
RR-Rest & Relaxation
-Yup. I just guessed and typed it in. I was happy not to get invalid or already redeemed.
ColaGal said on April 18, 2010
Here’s another big one to round out the week- good luck!
R-T-4-K-{-{-J-H-V-{-L-R (if the police catch this too high in your car you will get a ticket)
jojo said on April 18, 2010
RBM, THANKS
CodeCola said on April 18, 2010
RT4KmpJHVhLR RNBM.
Took me forever to figure that one out. Thanks for the puzzles. Keep em coming. I have to sharpen my brain. Maybe then, I’ll be able to get the next one 
Cyn said on April 18, 2010
So, what was the answer? It wasn’t RPM or BHP.
Cyn said on April 18, 2010
Duh, MPH. I coulda been a blonde. Or a contender. Anyway, it’s time for me to go fill up all of the accounts before the widgets slow down to a crawl. Take care all.
BetaID said on April 18, 2010
0 N K X F T R N 0 9 F M
~~~
3 Point Code From a 2 Liter Coca Cola. Good Luck!
LoCoCa said on April 19, 2010
0NKXFTRN09FM was RBM! thanks BetaID
cola monster said on April 19, 2010
aww man that was taken :-3
cola monster said on April 19, 2010
but not by me
cola monster said on April 19, 2010
i have to go school now, later guys! I’m coming back at 3:45 central time
Coke-addict said on April 19, 2010
Hi everyone! It’s a beautiful Monday and i am hoping to snag a code today since it’s my birthday!
CokeGirl said on April 19, 2010
Hey Code-addict HappY BirthDaY!!
I am hoping to a code too
BetaID said on April 19, 2010
Happy B-Day Coke-Addict
~~~
5 N A F K R R L A W 9 0
~~
10 Point Code From a 12 Pack Coca Cola. Good Luck!
Cyn said on April 19, 2010
5NAFKRRLAW90 RNBM. thanks anyway.
CodeCola said on April 19, 2010
5NAFKRRLAW90 RBM. Thanks for posting BetaID.
Happy b’day Code-addict !
acein said on April 19, 2010
5nafkrrlaw90… RNBM.. thanks for the chance
CokeGirl said on April 19, 2010
5nafkrrlaw90 RNBM. I was way too late!!
Coke-addict said on April 19, 2010
Thanks BetaID and Cokegirl but RNBM!
stonermac said on April 19, 2010
RNBM
5 N A F K R R L A W 9 0
ColaGal said on April 19, 2010
$-B-4-H-H-$-$-X-5-M-M-A (if you were flying in a
hot air balloon you would not want it to do these three letters)
It’s another BIG one! Thanks, Cokaholic!!
Also, happy bday to Coke-addict!
ColaGal said on April 19, 2010
Wow- it’s been really quiet tonight! Did anybody get the code?
Cyn said on April 19, 2010
Nope, I tried Pop and it came up invalid.
Mini! said on April 19, 2010
Wow. I’m pretty sure there’s something wrong with my coke rewards account or something — I tried your code with P 0 P as the blanks, but it came up as invalid. Then I tried a cap I had here, and it worked. The funny thing is, it just comes up as “not valid,” not “already used”…
CokeGirl said on April 19, 2010
Wow I was thinking it was gone long time ago! i got an error when I try what I think those 3 letters are.
BetaID said on April 19, 2010
wow it has been quiet i thought u were just late in updating. LOL
I didn’t get it
Coke-addict said on April 19, 2010
Thanks for the greetings ColaGal…
The last code is hard…. more hint please?
boredsilly said on April 20, 2010
I, for one, haven’t figured it out. Tried- dip, rip, pop, end, fal, all, lek, lak. Definitely, a tough one.
Filia said on April 20, 2010
Hey guys and gals!
Today is supposed to be the first day of online AMOE twist txt win codes being available… but I see nowhere where I can request a code online! Has anyone figured out how it works? Is coke just being really slow in updating the Rules page?
By the way, I guess we only get ten days of free online AMOE codes in each “wave” because the rules for “wave 2″ says June 20th – June 30th…
Filia said on April 20, 2010
Please ignore the previous comment. I figured out that there is a link in the bottom right hand corner of the home page. It says “AMOE Request Page” in black, but otherwise looks just like the button to go to the “twist txt win” page.
Mini! said on April 20, 2010
Well, just as a note, if you try words with “o”s in them, they have to translate to be zeros for the code. Now I don’t know if that means ColaGal intentionally avoided putting a o or 0 in the clue, or what…
Coke Cap Collector said on April 20, 2010
For the Dasani double points day, do they give you the extra points right when you enter your code, or later? And if you had diet coke caps couldn’t you just say it was Dasani when the “choose what drink” thing pops up?
stonermac said on April 20, 2010
$-B-4-H-H-$-$-X-5-M-M-A
wow, can’t figure this one out!
CokeGirl said on April 20, 2010
I don’t know about 20oz Dasani,however when I entered the regular Dasani water 24-pack in a previous promotion, I got the extra points right away!
ColaGal said on April 20, 2010
$-T-X-5-5-X-M-7-6-X-$-$ (you need one of these to cook your food)
Sorry about that last one, it was P0P. Maybe there was an error in the code, I’m not sure. All of these puzzle codes have been donated to you by Cokaholic. Thanks so much, Cokaholic!
You rock!!
cocacolagal1212 said on April 20, 2010
WOOO HOOO THANKS RBM
10 POINTS PTX55XM76AN THANKS EVEN THOUGH I GOT OVER 500 POINTS 
cocacolagal1212 said on April 20, 2010
oops i mean PTX55XM76XAN I MEAN
Coke Cap Collector said on April 20, 2010
Did anyone hear about the bonus points for diet coke from 4/26 to 5/2? Do you know how many bonus points there are?
ColaGal said on April 20, 2010
5-[-B-[-V-A-[-5-H-M-7-N (most jelly comes in this)
It’s a ten pointer! Thanks, Cokaholic!
Coke Cap Collector said on April 20, 2010
5JBAVAR5HM7N was RBM I’m so proud.
CodeCola said on April 20, 2010
5jBaVAr5HM7N RNBM. Thanks for posting, CG.
stephanie said on April 20, 2010
5bv5hm7njar it say the code is wrong.. so RNBM tys any ways
ColaGal said on April 20, 2010
F-A-?-?-J-W-M-V-F-H-4-7 (if it isn’t super fantastic it is “just” these two letters) Another biggie!
CamperXL said on April 20, 2010
FA0KJWMVFH47.. RNBM
Cyn said on April 20, 2010
CokeGirl said on April 20, 2010
faokjwmvfh47 RNBM. I can’t get any lately.
Have a great night everyone
jrmxCoke said on April 21, 2010
fa0kjwmvfh47 rnbm
cokaholic said on April 21, 2010
Hi guys, I don’t know what happened with that code, but the correct one is
P-B-4-H-5-0-P-X-5-M-M-A it was not the $-B-4-H-H-$-$-X-5-M-M-A that was posted – I goofed I guess and put an H for a 5 -SOOOOOOORRRRRRRRRYYYYYYY. Anyway, the correct answer was POP and this is the correct code and it is s big one, I hope one of you guys get it. P-B-4-H-5-0-P-X-5-M-M-A Please post and let us know if you get it – I hang onto the codes for a while to see if I make a mistake – sure glad I did this time.
cokaholic said on April 21, 2010
I have nothing to blame it on except that I just goofed!!!!!! Really sorry!
acein said on April 21, 2010
Cool… just checked email and I won a Samsung U10 Full HD Camcorder from Marlboro
Coke-addict said on April 21, 2010
Good day everyone!
CodeCola said on April 21, 2010
PB4H50PX5MMA RBM. Thanks so much cokaholic. It works great.
Coke-addict said on April 21, 2010
PB4H50PX5MMA RNBM but thanks anywayz cokaholic.
It happens sometimes
Acein, that is a big prize to win! Congratulations!
ColaGal said on April 21, 2010
Hi everyone! Hope you’re having a great day!
Cokaholic- Thanks so much for clarifying- I guess it’s my fault too, I should have double checked the real code before posting the puzzle. Thank you again for all you do!
We really, really appreciate all the codes and fun clues!
Acein- Wow! You are one lucky duck!!! I’m jealous!
Here’s another puzzle. Please let us know if you get it. %-%-X-V-W-R-J-4-M-6-9-% (a toddler is sometimes called these three letters) Good luck!
Cyn said on April 21, 2010
TOxvwrj4m69T RBM. Thanks to both of you.
Way to go Acein on your win.
CamperXL said on April 21, 2010
T0XVWRJ4M69T…RNBM
who has nemo said on April 21, 2010
A tot? never heard of it :/
CokeGirl said on April 21, 2010
Hey Acein, congrats!!
ColaGal said on April 21, 2010
4-W-X-T-6-6-X-9-T-K-#-# (these two letters are a popular type of ammo for pre-adults)
lol Thanks, Cokaholic!
Please let us know if you get it.
Cyn said on April 21, 2010
4wxt66x9tkBB as in BB gun. But, RNBM. Thanks anyway, both of you!
CokeGirl said on April 21, 2010
4wxt66x9tkbb RNBM. What should I do to get a code??? help!!! Just kidding!
Joe said on April 21, 2010
How many points do you all have? or do you constantly spend them?
who has nemo said on April 21, 2010
i got like 40 – 55 i forgot.. lol
Coke Cap Collector said on April 22, 2010
I have 1737 MCR points and am not spending them. I have been saving for something that is 2000 points, but I have spent 13 points on sweepstakes.
acein said on April 22, 2010
Thanks everyone! I am super excited!
Heather said on April 22, 2010
I had 1800 MCR points and spent about 1400 on magazine subscribtions for myself and family members. I recently saved up another 900 and redeemed them all for live nation concert cash that I plan on putting towards something this fall
ColaGal said on April 22, 2010
Woohoo! Here’s another BIG CODE! Please say if you get it.
B-9-K-V-9-M-6-&-&-&-A-0 (these three letters are the initials of the man who said “I have a dream”)
Thanks, Cokaholic!
WTG, Coke Cap Collector and Heather! That’s a lot of points!! (And a lot of magazines, lol!) Also, just FYI, I’m pretty sure you can’t stack the live nation concert cash. I really, really wish you could!
Concert tix are wayyyy too expensive!!!
Cyn said on April 22, 2010
brkv9m6 MLK a0 RBM. Ah, Martin Luther King, a man so wise and snuffed out too soon. Thanks so much, CG and Cokaholic, from me and my Special Munchkins.
stephanie said on April 22, 2010
b9kv9m6mlka0 RNBM ..shoot just missed ty anyways colagal … be back to try again another day …GBU
Coke Fan said on April 22, 2010
Afternoon All
CokeGirl said on April 22, 2010
I am only 38 point away to get the wireless headphones. Now I don’t drink sodas so I only get points with Dasany water and points I snag here and there.
BetaID said on April 22, 2010
R H 5 L K 0 4 6 4 H L P
~~~
Ten Point Code From a 12 Pack Fanta. Good Luck!
~~
Coke girl I don’t want to burst your bubble but I heard that the wireless headphones are not very good. The signal is not reliable and they’re kinda cheep. Again I just wanted to let you know that. If you really want them go ahead and get ‘em
Bob Zenith said on April 22, 2010
Here’s a code: 5VTMR4XFF6TP
HAPPY EARTH DAY!!!
BE GREEN!
LSU Fan said on April 22, 2010
5VTMR4XFF6TP was RBM. Thanks Bob.
Coke-addict said on April 22, 2010
too bad… RNBM for both codes… many thanks though….
CokeGirl said on April 22, 2010
BetaID, now I don’t know what to think. Cokaholic liked her headphones. She said they work well.
Cokaholic you told me I can see the reviews of the headphones in Dell. Do you mind to tell me the Dell part # for them? There are many wirelless headphones there.
Thanks to both of you.
who has nemo said on April 22, 2010
anyone know good places to look for coke codes that people dont use?
(besides a trash can)
cocacolagal1212 said on April 22, 2010
when i go to my local bingo they save them coke codes for me off them 12 or 24 pack can boxes or i look for some in the trash pile at my local flea market and my mama saves them for me my neaighbor does off the cap on diet coke and my aunt saves them and my cousin does too and a friend of mine too and i get some too i got a lott and will have some more tomm when i go to my flea market and look in the trash pile where they toss the empty boxes and may be have me some more coke codes and more points even though i got 410 points too enter in i will be maxed out for the next 3 weeks i am glad
ColaGal said on April 22, 2010
Thank you SO much to BetaID and Bob Zenith for your code donations! We really, really appreciate it!
who has nemo- try recycling bins (usually a little less gross than trash), ball games, theme parks… chances are anywhere that has a refreshment stand or stocks cans will have tons of them lying around to throw out. I’ve even heard of people bribing gas station employees into saving flaps for them!
You might also try just talking to the Coke guy who stocks the machines at your job. Just keep your eyes open everywhere for them. Hope this helps and best of luck to you!
Here’s another BIG code, it’s been a good day!
@-H-N-X-P-M-5-@-@-P-4-M (these three letters are kind of an old nickname for the basic school subjects) Good luck and let us know if you get it!
BetaID said on April 22, 2010
Coke Girl if you would like to see the reviews from Amazon(dot)com for the 5-in-1 Wireless Headphones go here.
http://www.amazon.com/MH2001-Hi-Fi-S-XBS-Wireless-Headphones/product-reviews/B0019FHM9M/ref=dp_top_cm_cr_acr_txt?ie=UTF8&showViewpoints=1
LoCoCa said on April 22, 2010
rhnxpm5rrp4m, but someone else got there first. RNBM
colayum said on April 22, 2010
i need some codes
mskei06 said on April 22, 2010
me too, lol:)
ColaGal said on April 23, 2010
Hi everyone, I’ll be AFK for most of the day- I’m starting a new job! Wish me luck!
Here’s another big code from Cokaholic:
F-P-5-&-&-L-F-7-4-M-7-T (these two numbers are the small version of what used to come in vinyl before they became obsolete)
Please post a comment if you get it, thanks.
acein said on April 23, 2010
FP545LF74M7T…RNBM… thanks for the Chance
who has nemo said on April 23, 2010
I just guessed and checked, and it said i did too many invalid redemption checks lol………………………………………………………………………………………………………………………
mskei06 said on April 23, 2010
FP545LF74M7T – it said code has already been used. Oh well…
Cyn said on April 23, 2010
Thanks for the code, Colagal and Cokaholic. It was for three poinhts. FP5 45 LF74M7T Good Luck on the new job!!
Mini! said on April 23, 2010
FP545LF74M7T but I didn’t get it, sob.
who has nemo said on April 23, 2010
i tried from the number “10″ to 70″ then it said i tried too many times. And, unfortunately, it’s still saying that.
cola monster said on April 23, 2010
Yeah me too, i guessed and checked
cocacolagal1212 said on April 23, 2010
I WENT BACK TOO MY LOCLA FLEA MARKET AND I FOUND IN THE TRASH PILE WHERE THEY TOSS THEM COKE BOXES AND I FOUND ME 7 10 POINTERS
NOW I GOT ALMOST 500 POINTS AGAIN WOOOOOOO WOOOOO I AM GLAD 
cocacolagal1212 said on April 23, 2010
THAT I DID COUNT I GOT 510 POINTS TOO ENTER AND BE MAXED OUT FOR THE NEXT 3 WEEKS MAY BE 4 IF I GET MORE
I AM GLAD 
cocacolagal1212 said on April 23, 2010
wow now i got a total of 540 points too enter wow wow
CodeCola said on April 23, 2010
Congrats on your new job, CG!!! I’m sure you’ll be great at it.
Coke Fan said on April 23, 2010
RNBM
ColaGal said on April 23, 2010
Hey everyone, thanks for posting back. My first day at the new job went really well, and I appreciate all the warm wishes!
Sorry about that last code being a 3 pointer instead of a big one like I thought… I checked the list again. Here’s one I’m fairly certain is several points:
6,H,X,4,^,^,7,R,P,A,J,T (you might get grounded if you were told to do something by your mother and you told her this slang word instead)
Good luck! And as always, please post when you get it.
Have an awesome Friday!
LSU Fan said on April 23, 2010
CG,
I can’t get 6,H,X,4,^,^,7,R,P,A,J,T to work with no, ah, ho, ha, or ma. Am I dense?
acein said on April 23, 2010
hmmm… I must have it wrong because I am getting invalid code on this.
ColaGal said on April 23, 2010
You’re so close, LSU Fan!
This is a tough one… I think you stumped ‘em, Cokaholic!
Here’s another hint. These two letters also stand for another phrase that means “does not apply”.
acein said on April 23, 2010
6hx4na7rPaJt… getting invalid code
LSU Fan said on April 23, 2010
NA – that doesn’t work either. LOL.
BigBopper said on April 23, 2010
invalid code with “na”
I’m stumped.
ColaGal said on April 23, 2010
Well, it was NA. I guess we had another code typo somewhere, maybe Cokaholic can check that one and clarify for us later. (thanks, Cokaholic!)
Sorry, guys! Here’s another one for your trouble: O,K,M,7,M,F,A,L,%,%,F,9 (these two letters are not the president, but almost) Good luck!
boredsilly said on April 23, 2010
rbm
O,K,M,7,M,F,A,L,vp,F,9
Thank you!
acein said on April 23, 2010
OKM7MFALVPF9… RNBM
rose said on April 23, 2010
I just found this site. I hope to find some codes too, I need over 1000 to get new ipod speakers.
ColaGal said on April 23, 2010
Hi rose, welcome to the site!
P*-4*-A*-L*-L*-5*-K*-H*-A*-L*-W*-K*
rose said on April 23, 2010
thanks! I was a little too late for your code.
Patrick said on April 23, 2010
Hey do you have any other codes. I need 900 mire for some sweet headphones and it would make my day if u could help me get there!!!
Patrick said on April 23, 2010
*more srry
CokeGirl said on April 23, 2010
hi everyone!
today my husband had surgery so I couldn’t enter here earlier and say hi.
ColaGal, good luck for your new job. Hope you like and enjoy it.
BetaID, thanks for the link. I will give them a try. I have found that everyone has a different opinion for the same things. Also, there are not other rewards that I really like.
ColaGal said on April 23, 2010
Hi CokeGirl- thanks for the warm wishes! Also, we hope that your husband is doing well and has a speedy recovery!
5-7-T-6-W-%-9-L-5-6-%-V (these two letters are your best friend, but not your best friend forever when texting. PS – Don’t text and drive!!!!!!) Thanks, Cokaholic! Hope you are feeling better also!
CodeCola said on April 23, 2010
57T6Wb9L56fV RBM. Thanks for posting the code and puzzle CG & Cokaholic. Again, congrats on your new job CG.
CokeGirl said on April 23, 2010
57t6wb9l56fv RNBM. Thanks anyway!
Let me tell you men are like little kids when they are in pain. They don’t know how to manage the pain at all. Thankfully he is sleeping now and the nausea is going away.
cokaholic said on April 24, 2010
Hi there all!! I think the correct code for that is T6HX4NA7RPAJ with the slang word being NA !!!! Oops again – tell us who gets this. Sorry I goofed – we can just blame that on my meds.
cokaholic said on April 24, 2010
Here is another big pointer because I goofed – R-W-V-5-P-9-H-#-#-B-5-# – these three letters are what an owl might say if you came knocking on his door.
cola monster said on April 24, 2010
It’s a great day here at Dallas.
cola monster said on April 24, 2010
For some reason, every time i’m not here, the codes are easy. But every time i am here, the codes get hard… wierd
cola monster said on April 24, 2010
Quiet………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………….
Where is everybody?
CodeCola said on April 24, 2010
RWV5P9HwhB5o RBM. Thanks so much for the code cokaholic! I won’t be able to use the computer this weekend. Lots of spring cleaning to do at home. So, have a great weekend. See you all next week.
ColaGal said on April 24, 2010
Good afternoon,
And as always, please post a reply if you get it. T-7-5-W->-R-7-K-9-J-H-> (these two letters are short for a motor home)
Hope you are all having a nice weekend. Here’s another puzzle code for someone- thanks, Cokaholic!
boredsilly said on April 24, 2010
T-7-5-W->-R-7-K-9-J-H-> rv
rbm
Thanks!
cola monster said on April 24, 2010
rnbm, it was r v as the two missing letters =[… would’ve been the first time i got a code lol
jojo said on April 24, 2010
T75W r R7K9JH v RNBM
Too late, but thanks
cola monster said on April 24, 2010
dang, but nice boredsilly
ColaGal said on April 24, 2010
^-W-B-B-^-7-B-^-9-9-7-R (these three letters are a popular form of dance)
CokeGirl said on April 24, 2010
TwbbA7bP997r RBM. I can’t believe it was still available. Thanks ColaGal and Cokaholic!!
rose said on April 24, 2010
twbba7bp997r TAP It was already used T.T
jojo said on April 24, 2010
TAP… RNBM
ColaGal said on April 25, 2010
7-F-7-(-X-R-(-6-6-V-L-(
(these three letters are what you need when you don’t know where you are going)
Good luck, and please let us know when it’s gone.
Don’t forget, you can snag free entries on mycoke.com until 4/30. Has anybody won anything using the online alternate entries (AMOE)? Just curious…
Have a great day!
Cyn said on April 25, 2010
F7mXRa66VLp RBM Thanks for the 3 points.
ColaGal said on April 25, 2010
A-P-5-H-F-T-F-$-$-$-6-L (these three letters are what you say when it is cold outside)
CokeGirl said on April 25, 2010
ap5hftfbrr6l RNBM. Thanks Colagal and Cokaholic!
Mini! said on April 25, 2010
Hey, cola monster, you mentioned Dallas — were you by any chance there for the VEX International Robotics competition?
Also, did anyone get the code that had to do with getting grounded?
cokefriend said on April 26, 2010
Does anyone know why are some being offered 20 bonus points for entering diet coke codes and others only 10?
ColaGal said on April 26, 2010
4-J-K-T-X-A-?-?-?-R-A-B (these three letters are what you sometimes call your buddy or best friend)
Good luck, and please let us know if you take it!
Cyn said on April 26, 2010
4JKTXA pal RAB RBM. Thanks for the 3 points. How’s the new job???
Cokefriend, it’s only speculation but it seems the more you enter weekly, the less your bonus appears to be. Just my view.
cola monster said on April 26, 2010
Cokefriend- It depends on sizes, idk if they are different sizes though
ColaGal said on April 26, 2010
N-W-#-6-B-#-5-K-F-K-9-F (these two letters are what you add to a son’s name when he is named after dad)
CodeCola said on April 26, 2010
NWj6Br5KFK9F RNBM. Thanks for posting CG.
CokeGirl said on April 26, 2010
nw j 6B r 5kfk9f RNBM. Thanks ColaGal and Cokaholic.
CokeGirl said on April 26, 2010
I just want to share with you my today’s good fortune. I won a $20 EDO card (texting), a $15 Best Buy GC, and a pair of movie tickets using the AMOE.
I am thinking that is happening because the promotions are almost over and the prizes haven’t been given away?
cocacolagal1212 said on April 26, 2010
hummmm i did enter me 5 diet coke codes and for some reason it did not credit me the bonus points i may have too call coke if it does not give me them bonus points i will wait and see if it does not i will call coke next monday and tell them
cocacolagal1212 said on April 26, 2010
did any one else get there bonus points ????
CodeCola said on April 27, 2010
CokeGirl: Congrats!!! I’m not so lucky. I’m still trying w/AMOE but nothing yet
cocacolagal1212: I bet the bonus points will be given out at the end of the promotion.
cola monster said on April 27, 2010
What is AMOE?
Filia said on April 27, 2010
Congrats CokeGirl! I don’t think it’s because it’s the end of the promo, I think it’s because you’re lucky! I’ve entered my 2 AMOE entries each day with no success so far… and today’s my last day to enter them until June since I’m flying out to Seattle for my uncle’s funeral tomorrow
Of course the funeral is MUCH more important than enter a few stupid codes online, so I’m not really upset.
I hope you’re new job is going well, ColaGal. Have a good day!
ColaGal said on April 27, 2010
4-K-M-%-R-N-%-K-4-%-X-N (these three letters are dynamite!)
CodeCola said on April 27, 2010
4KMtRNnK4tXN RBM. Thanks CG & Cokaholic for the code.
acein said on April 27, 2010
4KMTRNNK4TXN… RNBM… THANKS THOUGH!
CokeGirl said on April 27, 2010
4kmtrnnk4txn RNBM. Thanks anyway!!
CokeGirl said on April 27, 2010
Filia, sorry to hear about your loss. You are right, there are more important things to do and people to interact with that playing. I used to get upset because sometimes didn’t have time to enter codes or sweepstakes.
Cyn said on April 27, 2010
Filla, I will keep you and yours in my prayers during this difficult time.
CokeGirl, how is hubby? Hopefully is feeling better and not whining too much.
CG, please email me and let me know how you and ColaGuy have been and tell me about the new job.
CokeGirl said on April 27, 2010
Hi Cyn, thanks for asking. You made me laugh… he is ok now and he is not whining too much.
How is your foot?
Hope everyone is having a great day!
CokeGirl said on April 27, 2010
These Coke promotions are crazy. My MCR site says I get 20 points for the diet Coke. I got an email saying I can get 10 points for the same promotion. When I log in in my other (no points) account it says 15 points… I am totally confused!
CokeGirl said on April 27, 2010
Looking for the MCR rules I found this:
“CR Bonus Points::Powerade Play Bonus Points
Earn 10 Bonus Points when you enter your first POWERade Play code during the month of May (between May 1st and May 31st). Bonus Points are a one time offer. Remember, your Bonus Points don’t count towards your weekly limit, but the product codes still do.”
What is a POWERade play???
ColaGal said on April 27, 2010
&-P-X-5-L-X-J-&-&-H-N-J (this three letter insect will ruin a picnic)
Cyn said on April 27, 2010
a PX5LXJ n t HNJ RBM. Thanks for the 3 points.
I’m glad to hear that your hubby is better, CokeGirl. My Achilles tendon is still ruptured, but because the ortho doc showed me on spaghetti strand where it’s still attached, and because I don’t want to be on crutches for two solid months because of all the metal rods in my spine, I opted to not have surgery right now. I’m walking and doing, but I just can’t flex my foot. It’s still quite painful, but I have good drugs.
Thanks for asking.
CokeGirl said on April 27, 2010
Apx5lxjNThnj RNBM. Thanks Colagal and Cokaholic!
acein said on April 28, 2010
CokeGirl… POWERade Play is a type of POWERade I believe kinda like the Tiger version of Gatorade.
cola monster said on April 28, 2010
For some reason, this website laggs when i try to get on it.
Lisa said on April 28, 2010
Does anyone have any coke rewards that they can spare?
Thank you so much!
Coke Cap Collector said on April 28, 2010
CokeGirl POWERade Play is just powerade in smaller bottles. So if you have a regular POWERade bottle cap you can out it in as POWERade play (it can’t tell the difference)
Coke Cap Collector said on April 28, 2010
Can someone PLEASE PLEASE help me? Did any of you recieve your double points for the Earth Day DASANI thing? I should have 99 bonus points and never got them.
ColaGal said on April 28, 2010
Hi guys! Hope you’re having a nice week so far… I know I haven’t been around much today, so here’s a BIG code:
6-*6*-R-*J*-A-*J*-B-*A*-V-*N*-7-*R*
Please say if you get it!
Cyn- We’ve been doing just fine- busy, but good! The new job is going really well so far, I’m still getting used to things but I think I’m going to like it a lot!
Sorry to hear you’re still dealing with that darned Achilles, what a pain! (no pun intended) You are in our thoughts and prayers- hang in there!
CokeGirl- Way to go on your wins! That’s got to be some kind of record!!
As for bonus points, I’ve heard of lots and lots of people having issues with receiving theirs- most had to call or email customer service to get the points. Please let us know if you get it figured out!
Coke Cap Collector- I would contact customer service and ask them to credit the points to your account. (I can’t find the info right now- maybe someone out there can help?) They are usually pretty helpful. Best of luck, and please let us know how it turns out!
Lisa- Hi and welcome! All the codes posted here are first come, first served. Your best bet is to subscribe to the comments RSS or check back/refresh often for your chance to snag ‘em! Good luck and thanks for visiting the site!
Filia- Thank you for the kind words! We’re so very sorry to hear about your loss, and you and your family are in our thoughts and prayers. Travel safely and we look forward to having you back.
Okay, that’s it for now- I’ll try to post a few more codes tonight so stay tuned!
Cyn said on April 28, 2010
This is the information to contact Coke:
“You can also call us toll free, between 9:00 AM and 7:00 PM ET, Monday Through Friday, at 866-674-2653. or go to the bottom and click help and click talk to us and then click contact us.”
66RJAJBAVN7R RBM. Thanks for your generosity, both of you.
shanti said on April 28, 2010
New to site! Got in this late in the game…but trying to earn a nike card for my son. RNBM
CokeGirl said on April 28, 2010
Cyn, with just imagining what you wrote I feel the pain also. Hope you get better soon and don’t need surgery.
ColaGal said on April 28, 2010
B-9-[-[-F-5-W-7-[-J-M-T (this number and letters is when they stretch at the ball park)
Thanks Cokaholic!
boredsilly said on April 28, 2010
rbm B-9-7-t-F-5-W-7-h-J-M-T = 7th
Thank you!
CokeGirl said on April 28, 2010
b97tf5w7hjmt RNBM. Thanks anyway!
shanti said on April 28, 2010
rnbm
ColaGal said on April 29, 2010
R-W-6-P-6-X-R-{-{-{-5-6 (these three letters are a popular type of Dodge truck) Good luck, please comment if you use it!
LSU Fan said on April 29, 2010
RW6P6XRRAM56 was RBM. Woohoo. Thanks CG.
acein said on April 29, 2010
RW6P6XRram56… RNBM!
Chris said on April 29, 2010
RNBM RW6P6XR—56
Coke-addict said on April 29, 2010
Too bad, i haven’t snagged a code for a while now.
RW6P6XRRAM56 RNBM
Have a nice day everyone!
ColaGal said on April 29, 2010
(-(-W-(-V-9-5-W-F-4-6-4 (these three letters are a popular child’s lunch sandwich in crunchy or smooth)
Thanks Cokaholic!
CodeCola said on April 29, 2010
pbWjV95WF464v RBM. Thanks for posting, CG & Cokaholic.
acein said on April 29, 2010
PBwjv95wf464… Rnbm
ColaGal said on April 29, 2010
@-W-M-6-@-N-9-M-5-W-5-7 (these two letters are the abbreviation for Alabama)
Cyn said on April 29, 2010
aWM6lN9M5W57 rnbm, but thanks for sharing.
LSU Fan said on April 29, 2010
AWM6LN9M5W57 was RBM. Two in one day. I’m done, I’ll give everyone else a shot, LOL. Thanks CG.
mskei06 said on April 29, 2010
aWM6lN9M5W57 RNBM.
Coke Cap Collector said on April 29, 2010
YES! They gave me my 99 bonus points today(after emailing them repeatedly):)
ColaGal said on April 29, 2010
Way to go, LSU Fan and Coke Cap Collector!!!
6-R-B-9-^-N-7-K-K-6-^-^ (you press this three letter key with control and delete when your computer freezes) < – that’s a good one, Cokaholic!
Cyn said on April 29, 2010
6RB9aN7KK6lt RBM. Thanks so much to both of you.
Chris said on April 29, 2010
6RB9AN7KK6LT RNBM
CokeGirl said on April 29, 2010
6rb9an7kk6lt RNBM. I tried even though I knew it was already redeemed by somebody else.
ColaGal said on April 30, 2010
4-H-%-V-%-J-%-5-N-W-4-N (these three letters are not the bottom)
Good luck and please let us know if you get it!
Coke Fan said on April 30, 2010
Is anyone else having problems with the coke site. I get this message of an internal service error??????
Cyn said on April 30, 2010
CG, we can’t play right now. The site is down for maintenance for almost an hour now.
Coke Fan said on April 30, 2010
Thanks for the info Cyn….
cocacolagal1212 said on April 30, 2010
i wonder how long will the site my coke rewards be down for the maintenance work i wonder ???
Cyn said on April 30, 2010
Actually, BOTH sites are down. It may have something to do with the things that end today.
cocacolagal1212 said on April 30, 2010
i called coke and it said it will be down till 6 pm for maintenance work i am letting you all know
Coke Cap Collector said on April 30, 2010
MCR is on now and someone already used the code
Coke Cap Collector said on April 30, 2010
The website was on at exactly 6:00 I was refreshing the page, entered the code and it was used! I’m kind of suspicious.
cocacolagal1212 said on April 30, 2010
yeahhh the my coke rewards site is back up butt i was hoping coke would up up the coke limit butt nope
ColaGal said on April 30, 2010
5-W-#-9-#-#-7-W-T-H-A-T (these three letters are usually what you find a pair of shoes in)
Thanks Cokaholic!
BTW, who got the last one? Hope you’re all having a great night!
Cyn said on April 30, 2010
5W b 9 ox 7wthat RBM. Thank you both very much.
I don’t know on the last one, CG. I was making salmon patties and baked mac and cheese.
SBK1 said on April 30, 2010
I have yet to get a free code here (been trying for over a year). Tonight I thought was my night. As no one had “RBM” and I was within minutes of the posting. But says been used 5WB90X77WTHAT …
ColaGal said on April 30, 2010
SBK1- you must be mistaken, our site hasn’t even been up for a year yet!
But we wish you the best of luck snagging codes. Maybe some of our luckier ‘regulars’ can give you some tips on how they do it. Thanks, guys!
I’ll post a code in ten minutes, so stay tuned!
Aster said on April 30, 2010
Anyone ever get points with PowerAde zero cal? I think that it is totally unfair, you try to be healthy (not drinking 100 calories of sugar) and they say it is because of packaging they can’t give me the points on the zero?!?! UMMM? it is the SAME exact bottle as regular Powerade. I buy these for my hubby who works out but doesn’t want all the calories/sugar of the regular.
Cyn said on April 30, 2010
I would consider myself a “lucky regular”. I have been with ColaGal since day one, when she and her ColaGuy began this blog. I was also a “silent contributor” at times. I make sure I keep myself busy while I’m waiting for codes. I am working at my bing.com, my swagbucks.com, and mycoke.com, but I always remember to refresh the page every 30 or so seconds, hoping for one code at least. I try not to be a “code hog” and I share.
I hope this helps.
So welcome, SBK1. What took you so long to type to us?
ColaGal said on April 30, 2010
Okay, now I’m confused!
Should we call you SBK1 or Aster? (same person). Thanks for the post, though! I’ve always thought it was stupid that powerade zero doesn’t give codes, too! 
Cyn- thanks so much!! Our site definitely wouldn’t be the same without you and we are so glad you’re a part of it!
T-6-M-5-V-X-L-K-$-$-4-$ (these three letters are what you are on when you are running from the law)
Cokacodes said on April 30, 2010
People I’m stumped on this one
Hey everyone I’m new here….Just wanted to let you guys know so there is no confusion
ColaGal said on April 30, 2010
LOL, yeah I didn’t really get that one either…
It’s T-6-M-5-V-X-L-K-L-A-4-M. Please let us know as soon as it’s gone! Thank you
btw, welcome to the site Cokacodes! We’re happy to have you!!
CokeGirl said on April 30, 2010
t6m5vxlkla4m RNBM. Thanks anyway!
Cokacodes said on April 30, 2010
ok everyone don’t think I’m dumb here but…..what does RNBM and RBM mean
CokeGirl said on April 30, 2010
$20 Live Nation® Concert CashTM Voucher code:
8759373350552818
Redemption is easy:
1. Please go to http://www.livenation.com/cokeutc
2. Select “Concert Tickets” or “Artist Merchandise” button. Please note, code can only be used for merchandise OR tickets, not both.
3. For Artist Merchandise, select your preferred artist and start shopping. Once you cart your preferred items, enter your unique code provided above to apply to your merchandise purchase balance in the Promotional Code Box.
4. For Concert Tickets, select your preferred venue, event and ticket locations. Once you cart your preferred tickets, enter your unique code provided above to apply to your transaction balance in the Voucher Code Box.
5. Enjoy the show or your new concert swag!
cocaholic said on April 30, 2010
Oh come on you guys everybody knows what that means!!!!
From Wikipedia, the free encyclopedia
“On the lam”
“On the lam” or “on the run” often refers to fugitives. Mencken’s The American Language and The Thesaurus of American Slang proclaim that lam, lamister, and “on the lam” — all referring to a hasty departure — were common in thieves’ slang before the turn of the Twentieth century. Mencken quotes a newspaper report on the origin of ‘lam’ which actually traces it indirectly back to Shakespeare’s time.
There was even a STYX song about it in my high school days – “Oh mama, I’ve been years on the lam and had a high price on my head. Lawman said get him dead or alive now it’s for sure he’ll see me dead. Oh mama, I can hear you a crying so scared and all alone, hangman is coming down from the gallows and I don’t have very long.”
Anybody else remember that song?????
mskei06 said on May 1, 2010
8759373350552818 Code RNBM
stephanie said on May 1, 2010
cokecode It means Redeemed By Me and RNBM IS Redeemed Not By Me
Cokacodes said on May 1, 2010
been quiet so far today,hope everyone has had a great day so far
ColaGal said on May 1, 2010
7-X-F-&-&-P-5-B-L-9-A-K (these two letters are not your ma)
Cyn said on May 1, 2010
7XF ma P5BL9AK is RBM. Thank you both very much.
Cocaholic said on May 1, 2010
Cyn, that was supposed to be pa not ma – did I goof???
Cokacodes said on May 1, 2010
Thanks Stephanie
ColaGal said on May 1, 2010
Cocaholic- just got your email, thank you SO much!!!
you too, CokeGirl!!!
Cyn said on May 1, 2010
No, Cocaholic, you were fine. I goofed when I typed the code after using it. I stuck an “m” instead of a “p”. Maybe I was just so excited to get 3 points for my Special Munchkins.
Thanks.
CokeGirl said on May 1, 2010
hi everyone, hope you are enjoying the day!!
Cokacodes said on May 1, 2010
is anyone having the same problem as me…Sometimes I have like a 1 or 2 hour delay between retrieving messages from here.
and yes Coke-girl I am enjoying my day,how about you
BetaID said on May 1, 2010
wow, haven’t been here in a while
~~~
N F R T W N F J T A K X
~~
3 Point Code From a 2 Liter Minute Maid Lemonade. Good Luck
~
Have a Good Weekend!
BetaID said on May 1, 2010
Um…. u havin problems with site today? or is it just the host server?
I put a code up but after submit nothing happened and I got timed out.
If the code doesn’t appear I’ll post it later
Cyn said on May 1, 2010
NFRTWNFJTAKX is RNBM, but thanks for sharing BetaID.
I’m doing ok, ColaGirl. I hope you are too, now that hubby has simmered down on the whining.
chris said on May 1, 2010
hey can someone plz send me some codes im 12 an at school wen these codes r sent plz email em to me at chrisdimas_10@yahoo.com
ColaGal said on May 2, 2010
( ( V 5 5 ( R 9 V A H N (these three letters will make you a winner at tic tac toe)
Thank you, Cocaholic!
Cyn said on May 2, 2010
XXV55XR9VAHN comes up invalid. I think it’s 3 x’s to win tic tac toe.
UndersAng3l said on May 2, 2010
00V550R9VAHN RBM Thank You Very Much I Hope To Return The Favor Soon!
shanti said on May 2, 2010
Coke Girl: Thank you SO very much for the live nation code! I used it (gave to my son) who had a blast looking deciding what to order. He ended up getting some music. Think this was better than getting (never yet) a code! With much appreciation,
SS
ColaGal said on May 2, 2010
R H T A 9 X F M V * * * (these three letters are the button you push down when your parents say your stereo is too loud)
Have a nice night!
Cyn said on May 2, 2010
RHTA9XFMV vol RBM, thanks so much CG and CH.
cocacolagal1212 said on May 2, 2010
wow i sure got a lott lott of coke points 570 points enough for another year of the club pogo paid for yeahhhhh that is 570 i got not entered in enough too max out for the next 4 almost 5 weeks at 120 points each week i am glad
Thecool1 said on May 2, 2010
Havn’t been quick enough to snag a code yet but I’ll keep trying. In reference to the Styx song, the name is “Renegade”. I had the vinyl when I was a kid. Anyway thanks for the cool site!!
Claire said on May 2, 2010
RNBM!
Mhall said on May 2, 2010
RHTA9XFMVVOL-RNBM
mskei06 said on May 2, 2010
RHTA9XFMVvol RNBM
Mini! said on May 3, 2010
RHTA9XFMVV0L comes up as already used. RNBM.
Filia said on May 3, 2010
Thanks for the thoughts and prayers, everyone
The funeral service and memorial service were both very nice and it even managed not to rain. My uncle was a Vietnam veteran, and he had very much wanted a real bugler at his service. Despite my aunt being told that there was no way she could get a live bugler, my uncle’s wish came true! The regular fake bugle player had called in sick that day and a real bugler, who had come by request of a friend to a later service, had shown up early and was willing to play for ours as well. “Ask and you shall receive,” right? 
I also managed to find 7 coke codes in the airports and from family and have a promise from another uncle to be given a bunch of codes from his household too
I even got the stewardesses on the planes to give me the Sprite tabs used during the flight to send in to coke for Habit for Humanity… but I think they aren’t the right tabs… Does anyone know if they just have to be green to be eligible for that promotion?? I got the feeling that the tabs were actually shapped like houses, but I’ve never actually seen one of the “specially marked” cans.
Thanks again to everyone and I hope you’re all having a good start to your week!
ColaGal said on May 3, 2010
4 P T 6 % K K K 4 4 % % (these three letters are one of your upper limbs)
Glad you’re back, Filia!
Cyn said on May 3, 2010
4PT6aKKK44rm RBM. Thanks to both of you,m CG and CH.
Welcome back, Filla. I’m glad the service went so well. And way to go on spreading the word for your codes.
someegirl said on May 3, 2010
hi everyone. i have been on this site for awhile but I haven’t been able to get any codes:( it would be nice if someone could save one for me and not use it. my name is someegirl. it would be very helpful to me. thank you all:)
rose said on May 3, 2010
I got my neighbors to collect for me and I will be going out the night before trash day and trying to collect from the recycle bins. I hope I can get what I need before they either sell out or stop giving the items I want away.
to collectors, I suggest the trash thing, if your area recycles.
ColaGal said on May 3, 2010
6* H* 4* W* M* ?* N* T* T* H* J* ?* – (these two letters are found on beetles)
Thanks Cocaholic!
Hope you’re all having a nice night.
ColaGal said on May 3, 2010
Hi, I guess that last one is coming up as invalid… I checked it again and I’m not sure what it could be so I guess Cocaholic will have to help us out with that one.
I’ll post another one in about 30 minutes, so stay tuned and good luck!
homelost said on May 3, 2010
none of the codes seem to work
and it’s been more than 30 minutes 
ColaGal said on May 3, 2010
6 W H 9 5 M L / 5 / 7 / – (the Dallas Cowboys are members of this)
cocacolagal1212 said on May 3, 2010
6WH9MMLN5F7L THANKS RBM EVEN THOUGH I GOT OVER 600 POINTS TOO ENTER NOW THANKS AGAIN
cocacolagal1212 said on May 3, 2010
OOPS I TYPED IT WRONG IT WAS THIS 6WH95MLN5F7L SORRY
homelost said on May 3, 2010
@COLAGAL i don’t get it. are the letters dallas cowboys in it? and are the letter the same? Sorry i’m kind of new to this. :/ it’s fun guessing, just need all the fact as to how to guess lol
cocacolagal1212 said on May 3, 2010
9/F/6/6/T/M/?/?/677B THE 2 LETTERS IS THIS BUTT NOT AM IT IS THIS SINCE I TOOK THAT 3 POINTS THIS ONE IS OFF THE POWERADE PLAY COKE CODE AND IT WILL GIVE YOU THE 10 BONUS POINTS UNLESS IF YOU HAVE ALREADY USED A POWERADE PLAY CODE AND MAKE SURE YOU SELECT THE POWERADE PLAY COKE DRINK TOO HERE IS ONE I AM GIVING AWAY SINCE I TOOK THE LAST COKE CODE
drawnfade said on May 4, 2010
9F66TMPM677B RBM TYVM!
mskei06 said on May 4, 2010
9F66TMpm677B was RNBM:(
Cocaholic said on May 4, 2010
Hi there guys!! That is the correct code 6H4WMVNTTHJW – I double checked – I don’t know why it comes up invalid – I would send email mycoke rewards and tell them and they should credit the points to your account, make sure whoever does it posts that they have redeemed it or a lot of people will be emailing them. Laurie
Cocaholic said on May 4, 2010
This message is for homelost – the codes DO work, but sometimes I make a mistake or someone else does because the codes are hard to read at times. As for it being over 30 minutes before ColaGal got the next puzzle posted, you need to be more patient. This site is strictly a donated – first come – first served site and we all try to do what we can to share codes. This is not a job for any of us, it is all volunteer and if I goof or Colagal is 15 minutes or even and hour late posting a puzzle then it is because we are at work or busy with our everyday lives. When we have time it WILL get done. No one needs to be pressured. I know you are anxious, but there is no guarantee that even if you know the code answer that it hasn’t already been redeemed by someone else – we have lurkers who steal the codes from the people on this site and they never say RBM – they just take the codes. These are not very nice people. I hope they know about Karma – because what goes around DOES come around and they probably won’t win anything by using those codes because of how they got them. They could at least join the site like the rest of us and be curteous and post that they have redeemed them. Homelost – my point is, we are all doing this out of the kindness of our hearts and sharing with everyone on this site and you need to be a little kinder and not in such a hurry. This goes for a few others as well. I am sorry if I have offended anyone by posting this, but I felt it had to be said. I am off of my soapbox now. Laurie
BigBopper said on May 4, 2010
9F66TMpm677B RNBM
ColaGal said on May 4, 2010
Thanks so much, Laurie! I couldn’t have said it better myself!
And thank you again for all you do!!!
P @ @ @ @ 5 O F W H F H (these four letters are what you should do both ways before crossing the street) Good luck and please post a comment if you get it, thanks!
LSU Fan said on May 4, 2010
P LOOK 5OFWHFH was RBM! Thanks CG.
Cocaholic said on May 4, 2010
ColaGal, will you post again how to change the icon by our site names into a picture – this is probably the billionth time you’ve had to post it, but please one more time!!!!
ColaGal said on May 4, 2010
Sure Cocaholic, no problem! To change your geometric design, simply comment using a different email address. Everyone who has a photo or otherwise customized icon has registered and uploaded it through another site called gravatar.com. I think it’s free but I don’t use it, and it’s unaffiliated with freecokecodes.com, so register there at your own risk! I’ve also added this information to our FreeCokeCodes F.A.Q. page for future reference. (I actually thought it was in there already, so thanks for calling my attention to it!)
Have a great day, everyone!
sergio rodriguez said on May 4, 2010
hey im sergio im 14 years old and my teacher told me about mycokerewards.com so yeah if you don’t mind ColaGal i need some my teacher gave me three coke tops and i have 12 points know so like please if you do’t mind can u give me some and e-mail them to me if u can my e-mail is rsergio491@yahoo.com thanks
signed:sergio =)
Cocaholic said on May 4, 2010
ON MY SOAPBOX AGAN!!!!!!! Hey Sergio – glad you know about my coke rewards, but we do not send codes to anyone! Everything on this sight is first come – first served. What makes you or anyone else think that it would be fair to all of the people who regularly visit this site to try to solve the latest code game or puzzles so they can add points to their totals, if we just send you a bunch of codes. ColaGal is the administrator of this site and you are probably the 15th one to ask for codes in the past few weeks. THIS IS NOT HOW THIS SITE WORKS. ColaGal tries to make the codes accessable to everyone by having to solve a riddle, a puzzle or a game to EARN the code to you can add to your point totals on My Coke Rewards. So please people quit asking you are NOT going to get any codes except by solving a game or being the first to snag one that has been posted. Everyone please leave poor ColaGal alone – I think the way she runs this site is perfect. Again, I hope I have not offended anyone by posting this, but it had to be said. OFF MY SOAPBOX AGAIN!!!! Laurie
ColaGal said on May 4, 2010
4 J A F [ [ [ N N B 4 5 – (these three letters are what you sometimes call your sweetheart)
Thanks a million, Cocaholic!!!
Cyn said on May 4, 2010
4JAF hon NNB45 was RBM. Thanks so much to both of you.
Cokacodes said on May 4, 2010
4JAFHONNNB45 RNBM…..:(
CokeGirl said on May 4, 2010
Cokaholic, the problem is NEW people don’t read the top of the page. I don’t understand it because when you search and come up with this site the first thing you see is ColaGal welcoming, but it looks nobody takes the time to read it and realize this is not a place for begging… to bad
Please don’t take it too seriously … and you too ColaGal. IMHO it is better just to ignore those comments. Always will be somebody begging and/or demanding codes believing they have the right to do so.
Good night everyone!!!
jrmxCoke said on May 4, 2010
To Cocaholic and your recent posts off the soapbox: AMEN. I had noticed the recent prevalence of those who seemed not to read or understand ColaGal’s intro and instructions. Unreal.
Thanks to all on the head’s up on the Dasani earth day promo and the Diet Coke 10 point promo, would have never seen either if were not for this site.
In the spririt of the site, here is a little Power-Aid code- that is when it is entered, choose the smaller bottle and if you haven’t done so already, it will be worth 13 points!!!! Since it could be worth alot to someone, the code will be posted in my usual fashion. Please note, I spelled out both numbers within the code. The following sequence is 5′ to 3′:
BACTTTGAGGGTAGCTGTCJACCTCAGAAGTGGAGAACCCGTTTATTGTTGAGTAG
Have a good night all, unless you’re a Dodger fan, then I am sorry for who knew they’d be done nine already. No matter, the boys of chesse may easily find a way to blow it.
jrmxCoke said on May 4, 2010
Ooops, ‘done’ should be ‘down’ and ‘chesse’ should be ‘cheese.’ that should make more sense above.
CokeGirl said on May 5, 2010
jrmzCoke, like past codes, this is really hard. Why don’t you just translate into the amino acids like you did last time??
Of course, I am talking for myself and I don’t know if someone already figure it out
Rolo said on May 5, 2010
Hi Everyone. I’m new to the site but not to CokeGirl. Hi CokeGirl
I am looking for the Live Nation Cash codes and I’m willing to trade coke points for them, or something else of equal value.
I’m not sure how many points a cash code is worth to someone, but I’m sure we can work something out.
I have a trade working with CokeGirl and hopefully everything will go OK. Once it does she can vouch for my honesty.
Good luck to everyone with coke codes. This is a great promotion and I’ve been participating in it for quite sometime.
Rolo
ColaGal said on May 5, 2010
jrmxCoke- Thanks SO MUCH for donating a code!!!
Although I’m not sure if anyone has gotten it yet, we REALLY appreciate it!
Rolo- welcome to the site! We’re very glad to have you!
Please feel free to do any trading you’d like.
Hope everyone is having a nice Wednesday. Here’s a code. Please post a comment if you take it. Thanks. R ? K R 9 M R M ? F ? A (these three letters are how many of each kind of animal Noah put aboard the Ark)
CodeCola said on May 5, 2010
RtKR9MRMwFoA RNBM. Thanks for posting, CG.
Cyn said on May 5, 2010
RtKR9MRwFoA was RBM. Thanks so much, CG and CH.
Cocaholic said on May 5, 2010
Okay guys, here is a 20 pointer (I think) or a big pointer anyway – this is gonna be hard I think $-$-J-F-9-4-R-L-H-7-$-J. These three letters are a popular high school group to belong to kind of like PTA but it isn’t. Good Luck!!
jrmxCoke said on May 5, 2010
Alright, no worries, I will repost the code somewhat simpler:
BACTCTTCGGGTTGCAGTGJACT7CCC5TGA
I think there should be enough answers about this page or on page 24 to figure it out or goto http://algoart.com/aatable.htm
Also, I would be willing to trade codes that is a power aid cap code for another valid code. The power aid code could net one 3 points plus 10 bonus points if you haven’t already gotten the 10 bonus points for entering the little power aid cap code (I keep forgetting what these little power aid drinks are called). It is kinda stupid for me to have all of these codes when one can only get the bonus points once. Anyways I have 10 of these caps in my wad of caps.
Hope this ALL makes some sense with all. Will be up awhile watching west coast baseball.
CokeGirl said on May 5, 2010
Hi Rolo, did you get my email?? I received in the mail what you promised me. Thanks a lot!!
someegirl said on May 5, 2010
$-$-J-F-9-4-R-L-H-7-$-J
SGA? right? the code is not working…
Rolo said on May 5, 2010
Yeah CokeGirl, I got it. Thanks for the code, it worked great
LoCoCa said on May 5, 2010
wow, we have some smart stalkers, cuz btlrvavjt7p5 was rnbm. nice one, jrmxcoke
CokeGirl said on May 5, 2010
btlrvavjt7p5 RNBM Thanks jrmxCoke.
Cyn said on May 5, 2010
I saw the code almost immediately and spent half an hour playing. First I tried PTO then BPA, then quite a few others until I got locked out of one of the Special Ed accounts. I can’t wait to see what the correct answer is. Not having any high school kids of my own, and only teaching 5th grade and Special Ed, I’m at a loss. All I can say is: WAY TO GO to whomever figures it out. CH, you really stumped me.
Cocaholic said on May 5, 2010
Sorry SGA is not right!!!!
rose said on May 5, 2010
this is driving me crazy! I can’t figure it out and I just got out of high school
jrmxCoke said on May 6, 2010
Enough DNA, we’ll try baseball this time so maybe someone can get the 3 plus the 10 bonus points.
The code is: ?-?-@-T-W-M-@-N-@-F-N-0
?-? is what happens in my scorebook after four balls.
@-@-@ is how one would score an out after Casey McGehee throws a ball to Ryan Braun then Ryan Braun throws the ball to Jim Edmonds, who tags the runner out.
Anyways, if anyone wishes to trade codes that is a normal coke or sprite or minute maid cap for one of my power aid caps so you could get those 10 bonus points, just post so.
Have a great night all.
CodeCola said on May 6, 2010
Cocaholic’s code is really tough. I’m still unable to guess the 3 letters. Can we have more hints?
jrmxCoke said on May 6, 2010
Oooh, I got distracted by the game, but I forgot to mention, the code posted above is from a Power Aid cap so, pick the little bottle and you could get 3 plus the 10 Bonus points. Again, good luck and have a great night.
mskei06 said on May 6, 2010
Same here – I’ve been trying to figure this one out for an hour now!!!
Cocaholic said on May 6, 2010
It has an F in it!!!!
Evan said on May 6, 2010
hey everyone! I am new to the site. Thank you for all the codes.
Does anyone have a $100 Live nation concert cash code? I am in Japan but I am able to buy tickets online here. If anyone has some codes I would be really happy. Thank you and hugs to all of you.
Indra
mantra4utoo@yahoo.com
K2000G said on May 6, 2010
I think I got the code that jrmxCoke provided. It is bb5TWM7N9Fn0.
The first 2 letters are BB, which are shorthand for a walk in baseball. As for @-@-@, it is 5-7-9. The three names play for the Milwaukee Brewers. The numbers correspond to their position when they are fielding (5 – 3rd base: 7 and 9 are outfielders). Thank you, RBM.
BigBopper said on May 6, 2010
bb5TWM7N8FN0 returns an error in the code
BigBopper said on May 6, 2010
ptJF94RLH70J
ptJF94RLH7gJ
pcJF94RLH7cJ
ptJF94RLH7lJ
hsJF94RLH7aJ
paJF94RLH7cJ
psJF94RLH70J
All return an error in the code
Cocaholic said on May 6, 2010
Come on has anyone solved the puzzle yet??? It has to do with home economics!!!!
Cocaholic said on May 6, 2010
Okay, I give it is FHA as in Future Homemakers of America – can’t believe nobody got it!!!!!
Cocaholic said on May 6, 2010
I will think of some more really hard ones and see if you guys can get them – I am almost done with another big pointer list to send to ColaGal – I have to say, I am having so much fun doing this and watching to see who gets them!!!!! Glad I found you ColaGal!!!
jrmxCoke said on May 6, 2010
Nice job K2000G, hopefully you got the ten bonus points in addition to the three.
Boy, that 20 pointer question that is still out seems really hard. I have no clue onit since I am full for the week and haven’t tried.
Good luck all and have a great day.
Cyn said on May 6, 2010
Nope, would have never gotten it. Around here FHA means “Fair Housing Authority”.
CodeCola said on May 6, 2010
fhJF94RLH7aJ RBM. Thanks Cocaholic. The last few puzzles were great. I just don’t have the brain power to slove them. LOL. But keep them coming. I’m sure I’m bound to solve one eventually. Keep them puzzles coming…
ColaGal said on May 6, 2010
Thanks so much, everyone, and a big welcome to all of our new friends! Looks like it’s time for a new page, so I will put one up sometime tonight with another BIG code or two…
Cocaholic- It makes me very happy that you enjoy being a part of the site, and I must say I am very glad you found me too!!!
We couldn’t do it without all of your help and generosity- thank you so much again for everything!
CokeGirl said on May 6, 2010
Hi Everyone,
Cokaholic that code was too hard! And more for me that I am from this country. You don’t imagine how long I was googling to figure out the letters.
Like Cyn, I know FHA as the “Federal Housing Administration”
jrmxCoke, I figured your code out but I was too late. I like baseball; that’s the sport I watch.
Thanks for all the puzzles, they are really fun, even if I don’t get the codes.
ColaGal said on May 6, 2010
< F < R 6 X F 0 5 6 H T (she was the female agent on Get Smart)
Good luck and please post when redeemed! Thanks! (Still working on the new page, so stay tuned...) :D
acein said on May 6, 2010
9f9r6xf056ht… RBM! Thanks so much!!!
Cocaholic said on May 6, 2010
Okay guys here’s another big pointer – probably 20 points, but don’t want to make a mistake so let’s just call it a big pointer. ?-K-W-9-R-W-?-?-0-9-7-4. These three letters are a popular TV show that ran from 1986-1990. Good Luck!!
nitsua93 said on May 6, 2010
0HJA
FX7X
X7XN
It’s from a 12 pack. For some reason the code don’t work for me. I know it’s typed right. Maybe y’all can figure out why it won’t let me use. post when you got it.
BigBopper said on May 6, 2010
For me FHA is nothing like the PTA. One is a group for the parents, and the other is a group for the students, I was looking for parent groups.
Oh well, I tried.
Thanks for the opportunity to play.
LoCoCa said on May 6, 2010
akw9rwlf0974 was rbm! thanks so much cocaholic! and yes, it was for 20 points
Cocaholic said on May 6, 2010
FHA is a parent teacher organization that teaches young girls how to be homemakers, etc – we actually had to plan our own weddings down to every detail and the budget in that class for our final grades. Oh well, it is only a 20 point code, sorry it was too hard for you, but I thnk those bigger codes should be harder and then more people will have an opportunity to win them.
Cocaholic said on May 6, 2010
You got it too fast – wasn’t hard enough – I didn’t think anybody would get ALF. Congrats LoCoCa!!!
Cocaholic said on May 6, 2010
CodeCola – glad it was you who snagged the FHA one!!!!!
jrmxCoke said on May 6, 2010
To nitsua93, next time you get a 12 pack code that will not work like you described, if you email or call the help people at coke rewards and give them what coke brand it is, when you bought it, and where you bought it, they can and will credit your account. Hope this helps and you see this before Page 26 starts up.
Have a great night all.
ColaGal said on May 7, 2010
Okay, that’s it for the 25th page of FreeCokeCodes.com. Thanks so much for being a part of our site!
New Page